Uso de rizobacterias para el control de hongos fitopatógenos y promoción de crecimiento en plantas
DOI:
https://doi.org/10.59741/agraria.v3i1-2-3.528Palabras clave:
Bacillus subtilis, PCR, rizosferaResumen
Se aislaron dos bacterias de rizósfera de manzana y vainilla, denominadas (LPM1) y (LPM2) respectivamente, se identificaron como Bacillus subtilis usando un sistema biológico computarizado y la técnica de reacción en cadena de la polimerasa, utilizando los oligos G-849 5’ GCATATCGGTGTTAGTCCCGTCC 3’ y G-850 5’ TCGCTAGTAATCGCGGATCAGC 3’. Se determinaron características como tiempo de generación en dos medios de cultivos, infusión papa agar (IPA), e infusión papa agar sacarosa (IPAS), observándose mayor crecimiento celular en IPAS y el tiempo de generación de cada bacteria fue más corto con 0.74 h en IPAS que en IPA, donde su tiempo fue 1.18 h. Se observó diferencia en la sensibilidad a antibióticos por parte de las cepas. En la cromatografía en capa fina se obtuvieron bandas que, enfrentadas con Fusarium sp. alcanzaron un 39.42 % de inhibición. B. subtilis produjo sideróforos como un mecanismo de acción para inhibir hongos fitopatógenos. Las dos cepas LPM1 y LPM2 mostraron actividad enzimática como proteasas, amilasas y caseína. La evaluación de antagonismo in vitro contra Fusarium sp., Verticillium sp., Cephalosporium sp. y Dematophora sp., alcanzó un promedio de 26.51 % de inhibición por ambas cepas , donde LPM1 obtuvo mayor efecto con 39.3 % contra Verticillium sp. Además, los B. subtilis, presentaron capacidad para promover el desarrollo de sorgo, alcanzando mayor grosor, longitud y peso radicular. LPM1 estimuló mas el crecimiento de sorgo y frijol, mostrando valores superiores en longitud, peso radicular y peso fresco, aunque se comportó estadísticamente similar al tratamiento con LPM2.
Descargas
Referencias
Abbass, Z. and Y. OKon. 1993. Plant growth promotion by Azotobacter paspali in the rhizosphere. Soil Biochem. 25:1075-1083. DOI: https://doi.org/10.1016/0038-0717(93)90156-6
Alcaraz, F and B. Visitin Gy Garcia. 1999. Selección in vitro de Bacillus spp como biocontroladores de Fusarium. Rev. Argent. Fitopatol. 34(2).
Baker, R., Y. Elad and Y. Chet. 1984. The controlled ex periment in the scientific method with special enphasis on biological control. Phytopathol. 74:1019-1021. DOI: https://doi.org/10.1094/Phyto-74-1019
Baker; K. F. 1987. Evolving concepts of biological control of plant pathogens. Ann. Rev. Phytopathol. 25:67-85. Bari, T and Y. Okin. 1993. Tryptophan conversion to in dole-3-acetic acid via indole-3-acetamida in Azospirillum brasilense Sp7. Can. J. Microbiol. 39:81- 86. DOI: https://doi.org/10.1139/m93-011
Barnett, H and B. Hunter. 1998. Illustrated genera of im perfect fungi. 3rd ed. APS Press, St. Paul, Minnesota, USA. 218 p.
Belimov, A. A., V. I. Safronova and T. Mimur. 2002. Re sponse of spring rape (Brassica napus var. olifera
L.) to inoculation with plant growth promoting rhizobacteria containing 1 aminocyclopropane-1-car boxylate deaminase depends on nutrient status of the plant. Can. J. Microbiol. 48:189-199. DOI: https://doi.org/10.1139/w02-007
Berge, O., J. Fages, D. Mulard and J. Balandreau. 1990. Effects of inoculation with Bacillus circulans and Azospirillum lipoferum on crop-yield in field growth maize. Symbiosis 9:259-266.
Besoon, F., C. Chevanet and G. Michel. 1987. Influence of the culture medium on the production of iturin A by Bacillus subtilis. J. Gen. Mocrobiol. 133:767-672. DOI: https://doi.org/10.1099/00221287-133-3-767
Bloemberg, G. V and B. J. J. Lugtenberg. 2001. Molecu lar basis of plant growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol. 4:343-350. DOI: https://doi.org/10.1016/S1369-5266(00)00183-7
Cassan, F., R. Bottini, G. Schneider and P. Piccoli. 2001. Azospirillum brasilense and Azospirillum lipoferum hidrolyz conjugates of GA20 and metabolise that result ant aglycones to GA1in seedlings of rice dwarf mu tants. Plant Physiol. 125:2053-2058. DOI: https://doi.org/10.1104/pp.125.4.2053
Dashti, N., F. Zhang, R. Hynes and D. L. Smith. 1997. Plant and Soil.188, 33. DOI: https://doi.org/10.1023/A:1004295827311
Ferreira, J., F. N. Malthee and A. C. Thomas. 1991 Bio logical control of Eutypa lata on grapavine by a an tagonistic strain of Bacillus subtilis. Phytopathol. 81:283-287. DOI: https://doi.org/10.1094/Phyto-81-283
Fravel, D. R. 1988. Role of antibiosis in the biocontrol of plant diseases. Ann. Rev. Phytophatol. 26:75-91. Garcia de Salamone, I. E., R. K. Inés and L. M. Nelson. 2001. Cytokinin production by plant growth promoting rhizobacteria and selected mutants. Can J. Microbiol. 47:404-411. DOI: https://doi.org/10.1139/w01-029
Glick, B. R. 1995. The enhancenment of plant growth by free-living bacteria. Can. J. Microbiol. 41:109-117. Glick, B. R., C. L. Patten, O. Holguin and D. M. Penrose. DOI: https://doi.org/10.1139/m95-015
a. Biocontrol Mechanism. Chapter 7. pp. 86-133. In: Biochemical and genetic mechanism used by plant growth promoting bacteria. Imperial Collagge Press. Ontario, Canada.
Hernández, D. M y M. L. Charlloux. 2001. La nutrición mineral y la biofertilización en el cultivo del tomate (Lycopersicom esculentum Mill.) Temas Cien. Tecnol. 5:11-27.
Hernández, M. yA. Escalona. 2003. Microorganismos que benefician a las plantas: las bacterias PGPR. Revista de Divulgación Científica y Tecnológica de la Universidad Veracruzana. Veracruz. México. 16 (1).
Hong, Y., B. R. Glick and J. J. Pasternak. 1991. Plant microbial interaction under gnotobiotic conditions: A scanning electron microscope study. Current Microbiol. 23:111-114. DOI: https://doi.org/10.1007/BF02092259
Kloepper, J.W. 1991. Plant growth-promoting rhizobacteria as biological control agents of soilborne diseases. pp. 142-52. In: J. Bay-Peterson (Ed.) The biological con trol of plant diseases. Food and Fertilizer Technologi cal Center Taiwán.
Kloepper, J.W., R. Lifshitz and R. Zablotowicz. 1989. Free living bacterial inocula for enhancing crop productivity. Trends Biotecnol. 7:39-49. DOI: https://doi.org/10.1016/0167-7799(89)90057-7
Lagunas, L. J., Z. E. Mejia, O. S. Kawasoe y A. S. Ocampo. 2001. Bacillus firmus como agente de con trol biológico de Phytophthora capsici Leo. En jitomate (Lycopersicon esculentum Mill.). Rev. Mex. Fitopatol. 19 (1): 57-65.
Penrose, D. M and B. R. Glick. 2003. Methods for isola tion and characterization ACC deaminase-containing plant growth-promoting rhizobacteria. Physiol. Plant. 118:10-15. DOI: https://doi.org/10.1034/j.1399-3054.2003.00086.x
Pereira, J., A. R. Cavalcante, V. A. Baldani and J. Dobereiner. 1988. Sorghum and rice inoculation with
Azospirillum sp. Y Herbaspirillum seropedicae in field. Plant Soil. 110:269-274.
Podile, A. R and A. P. Prakash. 1996. Lysis and biological control of Aspergillus Níger by Bacillus subtilis AF-1. Can J. Microbiol. 42:533-538. DOI: https://doi.org/10.1139/m96-072
Schoroth, M. N and J. G. Hancock. 1981. Selected topics in biological control.Annu. Rev. Phytopathol. 35:453-476. Shah, S., J. Li, B. A. Moffatt and B. R.Glick. 1998. Isola tion and caracterization of ACC deaminase genes from two different plant growth promoting growth
rhizobacteria. Can. J. Microbiol. 44:833-843. Strenhoudt, O and J. Vanderleyden. 2000. Azospirillum, a free-living nitrogen-fixing bacterium closely associated with grasses; biochemical and ecological aspects. FEMS Microbiol. Rev. 24:487-506. DOI: https://doi.org/10.1111/j.1574-6976.2000.tb00552.x
Tapia-Hernández, A., M. A. Mascarua-Esparza and J. Caballero-Mellado. 1990. Production of bacteriocins and siderophore-like activity by Azospirillum brasilense. Microbios. 64:73-83.
Descargas
Publicado
Número
Sección
Licencia

Esta obra está bajo una licencia internacional Creative Commons Atribución-CompartirIgual 4.0.
Cómo citar
PLUMX Metrics
